ATG5 (NM_001286111) Human Untagged Clone

CAT#: SC333451

ATG5 (untagged) - Human autophagy related 5 (ATG5), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATG5
• Synonyms: APG5; APG5-LIKE; APG5L; ASP; hAPG5; SCAR25
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286111, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGATGACAAAGATGTGCTTCGAGATGTGTGGTTTGGACGAATTCCAACTTGTTTCACGCTATATC
  AGGATGAGATAACTGAAAGGGAAGCAGAACCATACTATACAGATTTGACCAGTTTTGGGCCATCAATCGG
  AAACTCATGGAATATCCTGCAGAAGAAAATGGATTTCGTTATATCCCCTTTAGAATATATCAGACAACGA
  CTGAAAGACCTTTCATTCAGAAGCTGTTTCGTCCTGTGGCTGCAGATGGACAGTTGCACACACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286111
• ORF Size: 276 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286111.1, NP_001273040.1
• RefSeq Size: 2890
• RefSeq ORF: 276
• Locus ID: 9474
• Protein Families: Druggable Genome
• Protein Pathways: Regulation of autophagy, RIG-I-like receptor signaling pathway
• Gene Summary: The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Several transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (5) lacks three alternate exons in the 5' coding region, which results in a frameshift in the remaining coding region, compared to variant 1. The encoded isoform (d) has the same N-terminus but is otherwise distinct and shorter than isoform a.