SNX12 (NM_001256186) Human Untagged Clone

CAT#: SC333457

SNX12 (untagged) - Human sorting nexin 12 (SNX12), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNX12
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256186, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGACACGGCAGTAGCTGATACCCGGCGCCTTAACTCGAAGCCGCAGGACCTGACCGACGCTTACG
  GGCCGCCAAGTAACTTCCTGGAGATCGACATCTTTAATCCTCAGACGGTGGGCGTGGGACGCGCGCGCTT
  CACCACCTATGAGACAAACCTACCTATCTTCAAGCTAAAGGAGTCCTGCGTACGGCGGCGCTACAGTGAC
  TTTGAGTGGCTGAAAAATGAGCTGGAGAGAGATAGCAAGAATTGCTGGGCACCCACTGGCTCAGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256186
• ORF Size: 279 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256186.1, NP_001243115.1
• RefSeq Size: 2279
• RefSeq ORF: 279
• Locus ID: 29934
• Gene Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. A similar protein in mouse may be involved in regulating the neurite outgrowth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (3) has multiple coding region differences, compared to variant 1, one of which results in a frameshift. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1.