PDE6D (NM_001291018) Human Untagged Clone

CAT#: SC333460

PDE6D (untagged) - Human phosphodiesterase 6D, cGMP-specific, rod, delta (PDE6D), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDE6D
• Synonyms: JBTS22; PDED
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291018, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCAGCCAAGGACGAGCGGGCCAGGGAGATCCTGAGGGGCTTCAAACTAAATTGGATGAACCTTCGGG
  ATGCTGAGACAGGGAAGATACTCTGGCAAGGAACAGAAGACCTGTCTGTCCCTGGTGTGGAGCATGAAGC
  CCGTGTTCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAACTTAATTTTTCTTCGACAGAACAA
  ATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGGCAATGCCTAGAAGTGGGAACGTTATCAT
  AG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291018
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291018.1, NP_001277947.1
• RefSeq Size: 1108 bp
• RefSeq ORF: 282 bp
• Locus ID: 5147
• Cytogenetics: 2q37.1
• Protein Pathways: Progesterone-mediated oocyte maturation, Purine metabolism
• Gene Summary: 'This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]'
  Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region resulting in a frameshift compared to variant 1. The encoded protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1.