TSH beta (TSHB) (NM_001277991) Human Untagged Clone

CAT#: SC333462

TSHB (untagged) - Human thyroid stimulating hormone, beta (TSHB), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TSHB
• Synonyms: TSH-B; TSH-BETA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001277991, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTCTTTTCTGTTCTTTCCCCAGGATATCAATGGCAAACTGTTTCTTCCCAAATATGCTCTGTCCC
  AGGATGTTTGCACATATAGAGACTTCATCTACAGGACTGTAGAAATACCAGGATGCCCACTCCATGTTGC
  TCCCTATTTTTCCTATCCTGTTGCTTTAAGCTGTAAGTGTGGCAAGTGCAATACTGACTATAGTGACTGC
  ATACATGAAGCCATCAAGACAAACTACTGTACCAAACCTCAGAAGTCTTATCTGGTAGGATTTTCTGTCT
  AA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277991
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277991.1, NP_001264920.1
• RefSeq Size: 364 bp
• RefSeq ORF: 282 bp
• Locus ID: 7252
• Cytogenetics: 1p13.2
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Autoimmune thyroid disease, Neuroactive ligand-receptor interaction
• Gene Summary: 'The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]'
  Transcript Variant: This variant (2) initiates translation at an alternate start codon and contains an intronless coding sequence, compared to variant 1. The encoded isoform (2, also known as novel TSH-beta) has a distinct N-terminus and is shorter than isoform 1. This variant is based on experimental data in PMIDs 19364510 and 22752807. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on data in published reports (PMIDs 19364510 and 22752807).