FKBP12 (FKBP1A) (NM_001199786) Human Untagged Clone
CAT#: SC333471
FKBP1A (untagged) - Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 3
"NM_001199786" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FKBP1A |
Synonyms | FKBP-1A; FKBP-12; FKBP1; FKBP12; PKC12; PKCI2; PPIASE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001199786, the custom clone sequence may differ by one or more nucleotides
ATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCG TGGTGCACTACACCGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTG CCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGA ATGACAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAG ACATGTGCACATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199786 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199786.1, NP_001186715.1 |
RefSeq Size | 1530 bp |
RefSeq ORF | 294 bp |
Locus ID | 2280 |
Cytogenetics | 20p13 |
Protein Families | Druggable Genome |
Gene Summary | 'The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]' Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235577 | FKBP1A (myc-DDK-tagged) - Human FK506 binding protein 1A, 12kDa (FKBP1A), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review