CLPS (NM_001252597) Human Untagged Clone

CAT#: SC333476

CLPS (untagged) - Human colipase, pancreatic (CLPS), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLPS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252597, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTCTCCTGCCTCAGCCTCCCAAGAAGCTGGGATTACAGGAGAACGGTGAGCTCTGCATGAATAGTG
  CCCAGTGTAAGAGCAATTGCTGCCAGCATTCAAGTGCGCTGGGCCTGGCCCGCTGCACATCCATGGCCAG
  CGAGAACAGCGAGTGCTCTGTCAAGACGCTCTATGGGATTTACTACAAGTGTCCCTGTGAGCGTGGCCTG
  ACCTGTGAGGGAGACAAGACCATCGTGGGCTCCATCACCAACACCAACTTTGGCATCTGCCATGACGCTG
  GACGCTCCAAGCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252597
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252597.1, NP_001239526.1
• RefSeq Size: 676 bp
• RefSeq ORF: 297 bp
• Locus ID: 1208
• Cytogenetics: 6p21.31
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: 'The protein encoded by this gene is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilizing an active conformation and considerably increasing the overall hydrophobic binding site. The gene product allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. This cofactor is only expressed in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]'
  Transcript Variant: This variant (2) contains an alternate exon compared to variant 1. Translation of variant 2 begins in the alternate exon, and the resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.