BLOC1S2 (NM_001282437) Human Untagged Clone
CAT#: SC333479
BLOC1S2 (untagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 4
"NM_001282437" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BLOC1S2 |
Synonyms | BLOS2; BORCS2; CEAP; CEAP11 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001282437, the custom clone sequence may differ by one or more nucleotides
ATGTTCTCCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGTGAAGACTATAAGCTCCTGG AAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATGAAAGATATTGCTATAAACATTAGTAGGAA CTTAAAGGACTTAAACCAGAAATATGCTGGACTGCAGCCTTATCTGGATCAGATCAATGTCATTGAAGAG CAGGTAGCAGCTCTTGAGCAGGCAGCTTACAAGTTGGATGCATATTCAAAAAAACTGGAAGCCAAGTACA AGAAGCTGGAGAAGCGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282437 |
ORF Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001282437.1, NP_001269366.1 |
RefSeq Size | 2798 |
RefSeq ORF | 300 |
Locus ID | 282991 |
Gene Summary | This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (4) uses an alternate splice site in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Variants 2, 4, and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235585 | BLOC1S2 (myc-DDK-tagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review