BLOC1S2 (NM_001282438) Human Untagged Clone

CAT#: SC333480

BLOC1S2 (untagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BLOC1S2
• Synonyms: BLOS2; BORCS2; CEAP; CEAP11
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282438, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCTCCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGTGAAGACTATAAGCTCCTGG
  AAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATGAAAGATATTGCTATAAACATTAGTAGGAA
  CTTAAAGGACTTAAACCAGAAATATGCTGGACTGCAGCCTTATCTGGATCAGATCAATGTCATTGAAGAG
  CAGGTAGCAGCTCTTGAGCAGGCAGCTTACAAGTTGGATGCATATTCAAAAAAACTGGAAGCCAAGTACA
  AGAAGCTGGAGAAGCGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282438
• ORF Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282438.1, NP_001269367.1
• RefSeq Size: 2649
• RefSeq ORF: 300
• Locus ID: 282991
• Gene Summary: This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (5) uses an alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2, 4, and 5 encode the same isoform (2).