ACYP1 (NM_001302616) Human Untagged Clone

CAT#: SC333483

ACYP1 (untagged) - Human acylphosphatase 1, erythrocyte (common) type (ACYP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ACYP1
• Synonyms: ACYPE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302616, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGGAAGGTGCAAGGGGTGTTTTTCC
  GTAAGCATACTCAGGCTGAGGGTAAAAAGCTGGGATTGGTAGGCTGGGTCCAGAACACTGACCGGGGCAC
  AGTGCAAGGACAATTGCAAGGTCCCATCTCCAAGGTGCGTCATATGCAGGAATGGCTTGAAACAAGAGGA
  AGTCCTAAATCACACATCGACAAAGCAAACTTCAACAATGAAAAAGTCATCTTGAAGTTGGATTACTCAG
  ACTTCCAAATTGTAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302616
• ORF Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001302616.1, NP_001289545.1
• RefSeq Size: 619
• RefSeq ORF: 300
• Locus ID: 97
• Protein Pathways: Pyruvate metabolism
• Gene Summary: This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode the same protein.