PEN2 (PSENEN) (NM_001281532) Human Untagged Clone

CAT#: SC333491

PSENEN (untagged) - Human presenilin enhancer gamma secretase subunit (PSENEN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSENEN
• Synonyms: ACNINV2; MDS033; MSTP064; PEN-2; PEN2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281532, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACCTGGAGCGAGTGTCCAATGAGGAGAAATTGAACCTGTGCCGGAAGTACTACCTGGGGGGGTTTG
  CTTTCCTGCCTTTTCTCTGGTTGGTCAACATCTTCTGGTTCTTCCGAGAGGCCTTCCTTGTCCCAGCCTA
  CACAGAACAGAGCCAAATCAAAGGCTATGTCTGGCGCTCAGCTGTGGGCTTCCTCTTCTGGGTGATAGTG
  CTCACCTCCTGGATCACCATCTTCCAGATCTACCGGCCCCGCTGGGGTGCCCTTGGGGACTACCTCTCCT
  TCACCATACCCCTGGGCACCCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281532
• ORF Size: 306 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001281532.1, NP_001268461.1
• RefSeq Size: 796
• RefSeq ORF: 306
• Locus ID: 55851
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Alzheimer's disease, Notch signaling pathway
• Gene Summary: Presenilins, which are components of the gamma-secretase protein complex, are required for intramembranous processing of some type I transmembrane proteins, such as the Notch proteins and the beta-amyloid precursor protein. Signaling by Notch receptors mediates a wide range of developmental cell fates. Processing of the beta-amyloid precursor protein generates neurotoxic amyloid beta peptides, the major component of senile plaques associated with Alzheimer's disease. This gene encodes a protein that is required for Notch pathway signaling, and for the activity and accumulation of gamma-secretase. Mutations resulting in haploinsufficiency for this gene cause familial acne inversa-2 (ACNINV2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.