Diazepam Binding Inhibitor (DBI) (NM_001282635) Human Untagged Clone

CAT#: SC333525

DBI (untagged) - Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DBI
• Synonyms: ACBD1; ACBP; CCK-RP; EP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282635, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGGGCGACCTCTGGCTCCTCCCGCCTGCCTCTGCCAATCCGGGCACTGGGACAGAGGCTGAGTTTG
  AGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAGCCATCGGATGAGGAGATGCTGTTCATCTATGG
  CCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAG
  GCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACA
  AAGTAGAAGAGCTAAAGAAAAAATACGGGATATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282635
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282635.1, NP_001269564.1
• RefSeq Size: 750 bp
• RefSeq ORF: 315 bp
• Locus ID: 1622
• Cytogenetics: 2q14.2
• Protein Families: Druggable Genome
• Protein Pathways: PPAR signaling pathway
• Gene Summary: 'This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (10) differs in the 5' UTR and 5' coding region, compared to variant 5. The resulting isoform (1) has a shorter and distinct N-terminus, compared to isoform 5. Variants 1, 7, 8, 9, and 10 encode the same isoform 1.