CCDC103 (NM_001258399) Human Untagged Clone
CAT#: SC333530
CCDC103 (untagged) - Human coiled-coil domain containing 103 (CCDC103), transcript variant 6
"NM_001258399" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCDC103 |
Synonyms | CILD17; PR46b; SMH |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001258399, the custom clone sequence may differ by one or more nucleotides
ATGGAAAGGAATGACATCATCAACTTCAAGGCTTTGGAGAAAGAGCTGCAGGCTGCACTCACTGCTGATG AGAAGTACAAACGGGAGAATGCTGCCAAGTTACGGGCAGTGGAACAGAGGGTGGCTTCCTATGAGGAGTT CAGGGGTATTGTCCTTGCATCACATCTGAAGCCACTGGAGCGGAAGGATAAGATGGGAGGAAAGAGAACT GTGCCCTGGAACTGTCACACTATTCAGGGAAGGACCTTCCAGGATGTGGCCACTGAAATCTCCCCGGTAG GAGAAAGCCCCCCTCCAGCCCGAGACGTCTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258399 |
ORF Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001258399.1, NP_001245328.1 |
RefSeq Size | 1770 |
RefSeq ORF | 315 |
Locus ID | 388389 |
Gene Summary | This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (6) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 4, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235636 | CCDC103 (myc-DDK-tagged) - Human coiled-coil domain containing 103 (CCDC103), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review