Cyclophilin A (PPIA) (NM_001300981) Human Untagged Clone

CAT#: SC333537

PPIA (untagged) - Human peptidylprolyl isomerase A (cyclophilin A) (PPIA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPIA
• Synonyms: CYPA; CYPH; HEL-S-69p
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300981, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGTCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTG
  AAGATGAGAACTTCATCCTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACAC
  AAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGGTGTTTGGC
  AAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCA
  AGAAGATCACCATTGCTGACTGTGGACAACTCGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300981
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300981.1, NP_001287910.1
• RefSeq Size: 2445 bp
• RefSeq ORF: 318 bp
• Locus ID: 5478
• Cytogenetics: 7p13
• Gene Summary: 'This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.