POLR2F (NM_001301131) Human Untagged Clone

CAT#: SC333540

POLR2F (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide F (POLR2F), transcript variant 4


  "NM_001301131" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "POLR2F"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLR2F
Synonyms HRBP14.4; POLRF; RPABC2; RPABC14.4; RPB6; RPB14.4; RPC15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301131, the custom clone sequence may differ by one or more nucleotides


ATGTCAGACAACGAGGACAATTTTGATGGCGACGACTTTGATGATGTGGAGGAGGATGAAGGGCTAGATG
ACTTGGAGAATGCCGAAGAGGAAGGCCAGGAGAATGTCGAGATCCTCCCCTCTGGGGAGCGACCGCAGGC
CAACCAGAAGCGAATCACCACACCATACATGACCAAGTACGAGCGAGCCCGCGTGCTGGGCACCCGAGCG
CTCCAGATTGCGATGTGTGCCCCTGTGATGGTGGAGCTGGAGGGGGAGACAGATCCTCTGCTCATTGCCA
TGAAGGAACTCAAGAGGCGGCGGCTCAGAGAGGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301131
ORF Size 318 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001301131.1, NP_001288060.1
RefSeq Size 1291
RefSeq ORF 318
Locus ID 5435
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) contains an alternate 3' exon structure, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.