POLR2F (NM_001301131) Human Untagged Clone
CAT#: SC333540
POLR2F (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide F (POLR2F), transcript variant 4
"NM_001301131" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | POLR2F |
Synonyms | HRBP14.4; POLRF; RPABC2; RPABC14.4; RPB6; RPB14.4; RPC15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301131, the custom clone sequence may differ by one or more nucleotides
ATGTCAGACAACGAGGACAATTTTGATGGCGACGACTTTGATGATGTGGAGGAGGATGAAGGGCTAGATG ACTTGGAGAATGCCGAAGAGGAAGGCCAGGAGAATGTCGAGATCCTCCCCTCTGGGGAGCGACCGCAGGC CAACCAGAAGCGAATCACCACACCATACATGACCAAGTACGAGCGAGCCCGCGTGCTGGGCACCCGAGCG CTCCAGATTGCGATGTGTGCCCCTGTGATGGTGGAGCTGGAGGGGGAGACAGATCCTCTGCTCATTGCCA TGAAGGAACTCAAGAGGCGGCGGCTCAGAGAGGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301131 |
ORF Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001301131.1, NP_001288060.1 |
RefSeq Size | 1291 |
RefSeq ORF | 318 |
Locus ID | 5435 |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
Gene Summary | This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (4) contains an alternate 3' exon structure, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235646 | POLR2F (myc-DDK-tagged) - Human polymerase (RNA) II (DNA directed) polypeptide F (POLR2F), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review