SNX3 (NM_001300928) Human Untagged Clone

CAT#: SC333542

SNX3 (untagged) - Human sorting nexin 3 (SNX3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNX3
• Synonyms: Grd19; MCOPS8; SDP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300928, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGAGACCGTGGCTGACACCCGGCGGCTGATCACCAAGCCGCAGAACCTGAATGACGCCTACGGAC
  CCCCCAGCAACTTCCTCGAGATCGATGTGAGCAACCCGCAAACGGTGGGGGTCGGCCGGGGCCGCTTCAC
  CACTTACGAAATCAGGGTCAAGACAAATCTTCCTATTTTCAAGCTGAAAGAATCTACTGTTAGAAGAAGA
  TACAGTGACTTTGAATGGCTGCGAAGTGAATTAGAAAGAGAGAGCAAGGGTCGCTGGTCATCCTCTGGCA
  CAGAACGAACGTTGTCTTCACATGTTTTTACAAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300928
• ORF Size: 318 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300928.1, NP_001287857.1
• RefSeq Size: 1652
• RefSeq ORF: 318
• Locus ID: 8724
• Gene Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. A pseudogene of this gene is present on the sex chromosomes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (3) lacks an exon in the 3' coding region, compared to variant 1, which results in a frameshift and a protein (isoform c) with a shorter and distinct C-terminus, compared to isoform a.