HOXD8 (NM_001199747) Human Untagged Clone

CAT#: SC333545

HOXD8 (untagged) - Human homeobox D8 (HOXD8), transcript variant 3


  "NM_001199747" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "HOXD8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HOXD8
Synonyms HOX4; HOX4E; HOX5.4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001199747, the custom clone sequence may differ by one or more nucleotides


ATGTTTCCGTGGATGAGACCACAAGCAGCTCCTGGTAGACGAAGAGGAAGACAAACCTACAGTCGCTTCC
AAACTCTAGAGTTGGAAAAGGAATTTCTTTTTAACCCCTATCTGACCAGGAAAAGAAGAATCGAGGTTTC
CCACGCCCTAGCCCTCACCGAGAGACAGGTAAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAAAAG
GAAAACAACAAGGACAAATTTCCCGTTTCCCGGCAGGAGGTGAAGGACGGGGAAACGAAAAAGGAAGCCC
AAGAGCTGGAGGAAGACAGAGCCGAAGGCCTGACAAATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001199747
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199747.1, NP_001186676.1
RefSeq Size 1624 bp
RefSeq ORF 321 bp
Locus ID 3234
Cytogenetics 2q31.1
Protein Families ES Cell Differentiation/IPS, Transcription Factors
Gene Summary 'This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. In addition to effects during embryogenesis, this particular gene may also play a role in adult urogenital tract function. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]'
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.