Ninjurin2 (NINJ2) (NM_001294346) Human Untagged Clone

CAT#: SC333546

NINJ2 (untagged) - Human ninjurin 2 (NINJ2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NINJ2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001294346, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGACGTGGCCCTGTTCATGTCCAACGCCATGCGGCTGAAGGCGGTGCTGGAGCAGGGACCATCCT
  CTCACTACTACACCACCCTGGTCACCCTCATCAGCCTCTCTCTGCTCCTGCAGGTGGTCATCGGTGTCCT
  GCTCGTGGTCATTGCACGGCTGAACCTGAATGAGGTAGAAAAGCAGTGGCGACTCAACCAGCTCAACAAC
  GCAGCCACCATCTTGGTCTTCTTCACTGTGGTCATCAATGTTTTCATTACAGCCTTCGGGGCACATAAAA
  CAGGGTTCCTGGCTGCCAGGGCCTCAAGGAATCCTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001294346
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001294346.1, NP_001281275.1
• RefSeq Size: 986 bp
• RefSeq ORF: 321 bp
• Locus ID: 4815
• Cytogenetics: 12p13.33
• Protein Families: Transmembrane
• Gene Summary: 'The protein encoded by this gene belongs to the ninjurin (for nerve injury induced) family. It is a cell surface adhesion protein that is upregulated in Schwann cells surrounding the distal segment of injured nerve, and promotes neurite outgrowth, thus may have a role in nerve regeneration after nerve injury. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (3) contains an alternate 5' terminal exon which results in a different 5' UTR and causes translation initiation at a downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. Variants 3 and 4 both encode the same isoform (3).