UCMA (NM_001303118) Human Untagged Clone
CAT#: SC333548
UCMA (untagged) - Human upper zone of growth plate and cartilage matrix associated (UCMA), transcript variant 2
"NM_001303118" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UCMA |
Synonyms | C10orf49; GRP; GRP/UCMA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001303118, the custom clone sequence may differ by one or more nucleotides
ATGACTTGGAGACAGGCCGTCCTGCTGTCTTGCTTCTCCGCCGTGGTGCTCCTGTCTATGCTGAGAGAGG GAACCAGTGTATCTGTGGGCACCATGCAGATGGCGGGAGAAGAGGCGAGTGAAGTGGAAAACAGGCAGAA GCTTCGGGTTGATGAGCTGCGGAGAGAATATTACGAGGAACAAAGGAATGAATTTGAGAACTTCGTGGAG GAACAAAACGATGAGCAGGAAGAGAGGAGCCGGGAGGCTGTGGAGCAGTGGCGCCAGTGGCACTATGACG GCCTGCACCCATCCTATCTCTACAACCGCCACCACACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001303118 |
ORF Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001303118.1, NP_001290047.1 |
RefSeq Size | 728 |
RefSeq ORF | 321 |
Locus ID | 221044 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a chondrocyte-specific, highly charged protein that is abundantly expressed in the upper immature zone of fetal and juvenile epiphyseal cartilage. The encoded protein undergoes proteolytic processing to generate a mature protein that is secreted into the extracellular matrix. The glutamic acid residues in the encoded protein undergo gamma carboxylation in a vitamin K-dependent manner. Undercarboxylation of the encoded protein is associated with osteoarthritis in humans. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235654 | UCMA (myc-DDK-tagged) - Human upper zone of growth plate and cartilage matrix associated (UCMA), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review