RPL36A (NM_001199972) Human Untagged Clone

CAT#: SC333549

RPL36A (untagged) - Human ribosomal protein L36a (RPL36A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL36A
• Synonyms: L36A; L44L; MIG6; RPL44
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199972, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTGCTCCTACCGACTCCCATGAGGAAGTGCGATCGGGAACCTCCTATATACTTCCGTTTGCCTCGC
  GGTTTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACTTT
  CTGTAAGAAGTGTGGCAAGCACCAACCCCATAAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTGTAC
  GCCCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGCTATGGTGGGCAAACTAAGCCGATTTTCCGGA
  AAAAGGTGAGTGGTAGTTACTATTTGACGTTTCCCAGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199972
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199972.1, NP_001186901.1
• RefSeq Size: 2361 bp
• RefSeq ORF: 321 bp
• Locus ID: 6173
• Cytogenetics: Xq22.1
• Protein Pathways: Ribosome
• Gene Summary: 'Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. Although this gene has been referred to as ribosomal protein L44 (RPL44), its official name is ribosomal protein L36a (RPL36A). This gene and the human gene officially named ribosomal protein L36a-like (RPL36AL) encode nearly identical proteins; however, they are distinct genes. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Naturally occurring read-through transcription occurs between this locus and the heterogeneous nuclear ribonucleoprotein H2 (H') gene. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a.