CXCL11 (NM_001302123) Human Untagged Clone

CAT#: SC333550

CXCL11 (untagged) - Human chemokine (C-X-C motif) ligand 11 (CXCL11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CXCL11
• Synonyms: b-R1; H174; I-TAC; IP-9; IP9; SCYB9B; SCYB11
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302123, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGTGAAGGGCATGGCTATAGCCTTGGCTGTGATATTGTGTGCTACAGTTGTTCAAGGCTTCCCCA
  TGTTCAAAAGAGGACGCTGTCTTTGCATAGGCCCTGGGGTAAAAGCAGTGAAAGTGGCAGATATTGAGAA
  AGCCTCCATAATGTACCCAAGTAACAACTGTGACAAAATAGAAGTGATTATTACCCTGAAAGAAAATAAA
  GGACAACGATGCCTAAATCCCAAATCGAAGCAAGCAAGGCTTATAATCAAATTGAAAGAAAGAATTTTTA
  AAAATATCAAAACATATGAAGTCCTGGAAAAGAGCATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302123
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302123.1, NP_001289052.1
• RefSeq Size: 1603 bp
• RefSeq ORF: 321 bp
• Locus ID: 6373
• Cytogenetics: 4q21.1
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Toll-like receptor signaling pathway
• Gene Summary: 'Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This antimicrobial gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]'
  Transcript Variant: This variant (2) uses an alternate splice junction in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (2) has a longer and distinct C-terminus compared to isoform 1.