NKAIN2 (NM_001300740) Human Untagged Clone

CAT#: SC333552

NKAIN2 (untagged) - Human Na+/K+ transporting ATPase interacting 2 (NKAIN2), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NKAIN2
• Synonyms: FAM77B; NKAIP2; TCBA; TCBA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300740, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCACCGATCTTGGTGGATGGAGAATGGACCAGGATGTACGGTGACGTCAGTGACACCTGCCCCAGACT
  GGGCCCCAGAAGACCATCGCTACATCACGGTCTCAGGGTGTTTGCTGGAGTACCAGTACATAGAAGTGGC
  TCATAGTTCCCTCCAGATTGTCCTCGCACTGGCAGGTTTCATCTACGCCTGTTATGTTGTGAAATGTATA
  ACTGAAGAAGAGGACAGCTTTGATTTCATAGGTGGCTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGA
  CATCTCATTTACAACTACAGCCTATGTACATGTCAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300740
• ORF Size: 321 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300740.1, NP_001287669.1
• RefSeq Size: 3031
• RefSeq ORF: 321
• Locus ID: 154215
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (5) represents use of an alternate promoter and therefore differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (5) with a shorter N-terminus, compared to isoform 1.