NKAIN2 (NM_001300740) Human Untagged Clone

CAT#: SC333552

NKAIN2 (untagged) - Human Na+/K+ transporting ATPase interacting 2 (NKAIN2), transcript variant 5


  "NM_001300740" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NKAIN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NKAIN2
Synonyms FAM77B; NKAIP2; TCBA; TCBA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300740, the custom clone sequence may differ by one or more nucleotides


ATGCACCGATCTTGGTGGATGGAGAATGGACCAGGATGTACGGTGACGTCAGTGACACCTGCCCCAGACT
GGGCCCCAGAAGACCATCGCTACATCACGGTCTCAGGGTGTTTGCTGGAGTACCAGTACATAGAAGTGGC
TCATAGTTCCCTCCAGATTGTCCTCGCACTGGCAGGTTTCATCTACGCCTGTTATGTTGTGAAATGTATA
ACTGAAGAAGAGGACAGCTTTGATTTCATAGGTGGCTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGA
CATCTCATTTACAACTACAGCCTATGTACATGTCAAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001300740
ORF Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001300740.1, NP_001287669.1
RefSeq Size 3031
RefSeq ORF 321
Locus ID 154215
Protein Families Transmembrane
Gene Summary This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (5) represents use of an alternate promoter and therefore differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (5) with a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.