p23 (PTGES3) (NM_001282605) Human Untagged Clone

CAT#: SC333570

PTGES3 (untagged) - Human prostaglandin E synthase 3 (cytosolic) (PTGES3), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTGES3
• Synonyms: cPGES; P23; TEBP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282605, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCCTGCTTCTGCAAAGTGGTACGATCGAAGGGACTATGTCTTCATTGAATTTTGTGTTGAAGACA
  GTAAGGATGTTAATGTAAATTTTGAAAAATCCAAACTTACATTCAGTTGTCTCGGAGGAAGTGATAATTT
  TAAGCATTTAAATGAAATTGATCTTTTTCACTGTATTGATCCAAATGATTCCAAGCATAAAAGAACGGAC
  AGATCAATTTTATGTTGTTTACGAAAAGGAGAATCTGGCCAGTCATGGCCAAGGTTAACAAAAGAAAGGG
  CAAAGGATTCACAAGACAGTGATGATGAAAAAATGCCAGATCTGGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282605
• ORF Size: 330 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282605.1, NP_001269534.1
• RefSeq Size: 1892
• RefSeq ORF: 330
• Locus ID: 10728
• Protein Families: Druggable Genome, Nuclear Hormone Receptor
• Gene Summary: This gene encodes an enzyme that converts prostaglandin endoperoxide H2 (PGH2) to prostaglandin E2 (PGE2). This protein functions as a co-chaperone with heat shock protein 90 (HSP90), localizing to response elements in DNA and disrupting transcriptional activation complexes. Alternative splicing results in multiple transcript variants. There are multiple pseudogenes of this gene on several different chromosomes. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (6) lacks two alternate in-frame exons, compared to variant 1. The encoded isoform (f) is shorter than isoform a.