Insulin (INS) (NM_001291897) Human Untagged Clone
CAT#: SC333575
INS (untagged) - Human insulin (INS), transcript variant 4
"NM_001291897" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | INS |
Synonyms | IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001291897, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAG CCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGG CTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGG GGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAAC AATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291897 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291897.1, NP_001278826.1 |
RefSeq Size | 529 bp |
RefSeq ORF | 333 bp |
Locus ID | 3630 |
Cytogenetics | 11p15.5 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Insulin signaling pathway, Maturity onset diabetes of the young, mTOR signaling pathway, Oocyte meiosis, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Regulation of autophagy, Type I diabetes mellitus, Type II diabetes mellitus |
Gene Summary | 'This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020]' Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235681 | INS (myc-DDK-tagged) - Human insulin (INS), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review