Insulin (INS) (NM_001291897) Human Untagged Clone

CAT#: SC333575

INS (untagged) - Human insulin (INS), transcript variant 4


  "NM_001291897" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol INS
Synonyms IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291897, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAG
CCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGG
CTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGG
GGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAAC
AATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291897
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291897.1, NP_001278826.1
RefSeq Size 529 bp
RefSeq ORF 333 bp
Locus ID 3630
Cytogenetics 11p15.5
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
Protein Pathways Insulin signaling pathway, Maturity onset diabetes of the young, mTOR signaling pathway, Oocyte meiosis, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Regulation of autophagy, Type I diabetes mellitus, Type II diabetes mellitus
Gene Summary 'This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020]'
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.