Nociceptin (PNOC) (NM_001284244) Human Untagged Clone

CAT#: SC333581

PNOC (untagged) - Human prepronociceptin (PNOC), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PNOC
• Synonyms: N/OFQ; NOP; OFQ; ppN/OFQ; PPNOC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001284244, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAGGAGCTCTTGGCAGCTCAGCCCTGCCGCCCCAGAGCATGTGGCGGCTGCTCTCTACCAGCCGA
  GAGCTTCGGAGATGCAGCATCTGCGGCGAATGCCCCGAGTCCGGAGCTTGTTCCAGGAGCAGGAAGAGCC
  CGAGCCTGGCATGGAGGAGGCTGGTGAGATGGAGCAGAAGCAGCTGCAGAAGAGATTTGGGGGCTTCACC
  GGGGCCCGGAAGTCGGCCAGGAAGTTGGCCAATCAGAAGCGGTTCAGTGAGTTTATGAGGCAATACTTGG
  TCCTGAGCATGCAGTCCAGCCAGCGCCGGCGCACCCTGCACCAGAATGGTAATGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284244
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001284244.1, NP_001271173.1
• RefSeq Size: 1022 bp
• RefSeq ORF: 339 bp
• Locus ID: 5368
• Cytogenetics: 8p21.1
• Protein Families: Secreted Protein
• Gene Summary: 'This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include nociceptin, nocistatin, and orphanin FQ2 (OFQ2). Nociceptin, also known as orphanin FQ, is a 17-amino acid neuropeptide that binds to the nociceptin receptor to induce increased pain sensitivity, and may additionally regulate body temperature, learning and memory, and hunger. Another product of the encoded preproprotein, nocistatin, may inhibit the effects of nociceptin. [provided by RefSeq, Jul 2015]'
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start site compared to variant 1. The encoded isoform (2) lacks a signal peptide sequence and has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.