n-Myc (MYCN) (NM_001293233) Human Untagged Clone
CAT#: SC333583
MYCN (untagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 2
"NM_001293233" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MYCN |
Synonyms | bHLHe37; MODED; N-myc; NMYC; ODED |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001293233, the custom clone sequence may differ by one or more nucleotides
ATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCGAGCAAGCGCTAGCCAGGCGCAAGCGCGCACAGACTG TAGCCATCCGAGGACACCCCCGCCCCCCCGGCCCACCCGGAGACACCCGCGCAGAATCGCCTCCGGATCC CCTGCAGTCGGCGGGAGTGTTGGAGGTCGGCGCCGGCCCCCGCCTTCCGCGCCCCCCACGGGAAGGAAGC ACCCCCGGTATTAAAACGAACGGGGCGGAAAGAAGCCCTCAGTCGCCGGCCGGGAGGCGAGCCGATGCCG AGCTGCTCCACGTCCACCATGCCGGGCATGATCTGCAAGAACCCAGACCTCGAGTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293233 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001293233.1, NP_001280162.1 |
RefSeq Size | 2736 bp |
RefSeq ORF | 339 bp |
Locus ID | 4613 |
Cytogenetics | 2p24.3 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]' Transcript Variant: This variant (2) lacks segment 1b in the 5' region, compared to variant 1. This variant includes two open reading frames; the isoform (3, also known as MYCNOT, see PMID: 20017904) represented by this Refseq is translated from the upstream open reading frame. The isoform 3 has an identical N-terminus to that of the isoform 2, and the function of the isoform 3 is currently unknown. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235689 | MYCN (myc-DDK-tagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review