POLR2H (NM_001278699) Human Untagged Clone

CAT#: SC333598

POLR2H (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide H (POLR2H), transcript variant 3


  "NM_001278699" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "POLR2H"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLR2H
Synonyms RPABC3; RPB8; RPB17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278699, the custom clone sequence may differ by one or more nucleotides


ATGGATCTAATCTTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCA
TAGCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGATAGGCCTTC
CAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAGGGAGATGAAACTTCTACT
GAAGCAGCAACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTGCAGGGGGATGCCA
ACAACCTGCATGGATTCGAGGTGGACTCCAGAGTTTATCTCCTGATGAAGAAGCTAGCCTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278699
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278699.1, NP_001265628.1
RefSeq Size 1273 bp
RefSeq ORF 345 bp
Locus ID 5437
Cytogenetics 3q27.1
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary 'The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (3) differs in the 5' UTR, uses a downstream start codon and uses an alternate splice site in the 3' coding region, resulting in a frameshift, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.