POLR2H (NM_001278700) Human Untagged Clone
CAT#: SC333599
POLR2H (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide H (POLR2H), transcript variant 4
"NM_001278700" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | POLR2H |
Synonyms | RPABC3; RPB8; RPB17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278700, the custom clone sequence may differ by one or more nucleotides
ATGGATCTAATCTTAGATGTAAACATTCAAATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCA TAGCTAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACTGATGATAGGCCTTC CAGGGCTGACCAGTTTGAGTATGTAATGTATGGAAAAGTGTACAGGATTGAGGGAGATGAAACTTCTACT GAAGCAGCAACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTGCAGGGGGATGCCA ACAACCTGCATGGATTCGAGGTGGACTCCAGAGTTTATCTCCTGATGAAGAAGCTAGCCTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278700 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278700.1, NP_001265629.1 |
RefSeq Size | 1114 bp |
RefSeq ORF | 345 bp |
Locus ID | 5437 |
Cytogenetics | 3q27.1 |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
Gene Summary | 'The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]' Transcript Variant: This variant (4) contains an alternate 5' terminal exon, initiates translation at a downstream start codon and uses an alternate splice site in the 3' coding region, resulting in a frameshift, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235705 | POLR2H (myc-DDK-tagged) - Human polymerase (RNA) II (DNA directed) polypeptide H (POLR2H), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review