BAX (NM_001291431) Human Untagged Clone
CAT#: SC333600
BAX (untagged) - Human BCL2-associated X protein (BAX), transcript variant zeta
"NM_001291431" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BAX |
Synonyms | BCL2L4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291431, the custom clone sequence may differ by one or more nucleotides
ATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTG ACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCCCT GTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCCGGGAGCGGCTG TTGGGCTGGATCCAAGACCAGGGTGGTTGGGACGGCCTCCTCTCCTACTTTGGGACGCCCACGTGGCAGA CCGTGACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTCACCATCTGGAAGAAGATGGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291431 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291431.1, NP_001278360.1 |
RefSeq Size | 621 bp |
RefSeq ORF | 345 bp |
Locus ID | 581 |
Cytogenetics | 19q13.33 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Huntington's disease, Neurotrophin signaling pathway, p53 signaling pathway, Pathways in cancer, Prion diseases |
Gene Summary | 'The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. The association and the ratio of BAX to BCL2 also determines survival or death of a cell following an apoptotic stimulus. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Dec 2019]' Transcript Variant: This variant (zeta) lacks two consecutive exons in the 5' region which causes translation initiation at a downstream start codon, and has an alternate splice site in the 3' coding region which causes a frame-shift, compared to variant 1. The resulting isoform (zeta) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235706 | BAX (myc-DDK-tagged) - Human BCL2-associated X protein (BAX), transcript variant zeta |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review