Apc10 (ANAPC10) (NM_001256711) Human Untagged Clone
CAT#: SC333601
ANAPC10 (untagged) - Human anaphase promoting complex subunit 10 (ANAPC10), transcript variant 7
"NM_001256711" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ANAPC10 |
Synonyms | APC10; DOC1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256711, the custom clone sequence may differ by one or more nucleotides
ATGACTACACCAAACAAGACACCTCCTGGTGCTGACCCCAAGCAGTTGGAAAGGACTGGAACAGTACGGG AAATTGGGTCACAAGCTGTTTGGTCACTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGAGA TGACAATCTAGAAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAGAAGA AAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAAAGCTATACTCCAAGCAAGA TCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTCAAGAAATTCGGGCTTTGGTATCAGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256711 |
ORF Size | 345 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256711.1, NP_001243640.1 |
RefSeq Size | 1579 |
RefSeq ORF | 345 |
Locus ID | 10393 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
Gene Summary | ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]). [supplied by OMIM, Feb 2011] Transcript Variant: This variant (7) differs in the 5' UTR and includes an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. Variants 6 and 7 encode the same isoform (3), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235707 | ANAPC10 (myc-DDK-tagged) - Human anaphase promoting complex subunit 10 (ANAPC10), transcript variant 7 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review