CNIH4 (NM_001277198) Human Untagged Clone
CAT#: SC333604
CNIH4 (untagged) - Human cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 3
"NM_001277198" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNIH4 |
Synonyms | CNIH-4; CNIH2; HSPC163 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001277198, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCGGTGGTGTTCGTCTTCTCTCTCCTCGATTGTTGCGCGCTCATCTTCCTCTCGGTCTACTTCA TAATTACATTGTCTGATTTAGAATGTGATTACATTAATGCTAGATCATGTTGCTCAAAATTAAACAAGTG GGTAATTCCAGAATTGATTGGCCATACCATTGTCACTGTATTACTGCTCATGTCATTGCACTGGTTCATC TTCCTTCTCAACTTACCTGTTGCCACTTGGAATATATATCGAAATACACAATCGAGGGCAGCTGAAGTCA CACATGAAAGAAGCCATGATCAAGCTTGGTTTCCACTTGCTCTGCTTCTTCATGTATCTTTATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277198 |
ORF Size | 345 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001277198.1, NP_001264127.1 |
RefSeq Size | 1590 |
RefSeq ORF | 345 |
Locus ID | 29097 |
Protein Families | Transmembrane |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235710 | CNIH4 (myc-DDK-tagged) - Human cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review