CNIH4 (NM_001277198) Human Untagged Clone

CAT#: SC333604

CNIH4 (untagged) - Human cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 3


  "NM_001277198" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CNIH4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CNIH4
Synonyms CNIH-4; CNIH2; HSPC163
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001277198, the custom clone sequence may differ by one or more nucleotides


ATGGAGGCGGTGGTGTTCGTCTTCTCTCTCCTCGATTGTTGCGCGCTCATCTTCCTCTCGGTCTACTTCA
TAATTACATTGTCTGATTTAGAATGTGATTACATTAATGCTAGATCATGTTGCTCAAAATTAAACAAGTG
GGTAATTCCAGAATTGATTGGCCATACCATTGTCACTGTATTACTGCTCATGTCATTGCACTGGTTCATC
TTCCTTCTCAACTTACCTGTTGCCACTTGGAATATATATCGAAATACACAATCGAGGGCAGCTGAAGTCA
CACATGAAAGAAGCCATGATCAAGCTTGGTTTCCACTTGCTCTGCTTCTTCATGTATCTTTATAG


Restriction Sites SgfI-MluI     
ACCN NM_001277198
ORF Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001277198.1, NP_001264127.1
RefSeq Size 1590
RefSeq ORF 345
Locus ID 29097
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.