VAMP1 (NM_001297438) Human Untagged Clone

CAT#: SC333624

VAMP1 (untagged) - Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 4


  "NM_001297438" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "VAMP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VAMP1
Synonyms CMS25; SPAX1; SYB1; VAMP-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297438, the custom clone sequence may differ by one or more nucleotides


ATGTCTGCTCCAGCTCAGCCACCTGCTGAAGGGACAGAAGGGACTGCCCCAGGTGGGGGTCCCCCTGGCC
CTCCTCCTAACATGACCAGTAACAGACGACTACAGCAAACCCAGGCACAAGTGGAGGAGGTGGTGGACAT
CATACGTGTGAACGTGGACAAGGTCCTGGAGAGGGACCAGAAGCTGTCAGAGCTGGATGACCGAGCTGAT
GCCTTGCAGGCAGGAGCATCACAATTTGAGAGCAGTGCTGCCAAGCTAAAGAGGAAGTATTGGTGGAAAA
ACTGCAAGATGATGATCATGCTGGGAGCCATCTGTGCCATCATCGTGGTAGTTATTGTAAGAAGAGGCTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001297438
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297438.1, NP_001284367.1
RefSeq Size 1453 bp
RefSeq ORF 351 bp
Locus ID 6843
Cytogenetics 12p13.31
Protein Families Secreted Protein, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Gene Summary 'Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014]'
Transcript Variant: This variant (4) contains an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Isoforms 3 and 4 are the same length but differ in their C-termini.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.