POLR2F (NM_001301129) Human Untagged Clone

CAT#: SC333650

POLR2F (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide F (POLR2F), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POLR2F
• Synonyms: HRBP14.4; POLRF; RPABC2; RPABC14.4; RPB6; RPB14.4; RPC15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301129, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTCTCGATCTCCTGCCTTGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGAAGGCC
  AGGAGAATGTCGAGATCCTCCCCTCTGGGGAGCGACCGCAGGCCAACCAGAAGCGAATCACCACACCATA
  CATGACCAAGTACGAGCGAGCCCGCGTGCTGGGCACCCGAGCGCTCCAGATTGCGATGTGTGCCCCTGTG
  ATGGTGGAGCTGGAGGGGGAGACAGATCCTCTGCTCATTGCCATGAAGGAACTCAAGGCCCGAAAGATCC
  CCATCATCATTCGCCGTTACCTGCCAGATGGGAGCTATGAAGACTGGGGGGTGGACGAGCTCATCATCAC
  CGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301129
• ORF Size: 357 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301129.1, NP_001288058.1
• RefSeq Size: 2207
• RefSeq ORF: 357
• Locus ID: 5435
• Protein Families: Transcription Factors
• Protein Pathways: Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
• Gene Summary: This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) contains an alternate exon in the 5' region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.