NKAIN2 (NM_001300738) Human Untagged Clone

CAT#: SC333653

NKAIN2 (untagged) - Human Na+/K+ transporting ATPase interacting 2 (NKAIN2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NKAIN2
• Synonyms: FAM77B; NKAIP2; TCBA; TCBA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300738, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAACAGACCTTATCCTGACTTTTAATATATCAATGCACCGATCTTGGTGGATGGAGAATGGACCAG
  GATGTACGGTGACGTCAGTGACACCTGCCCCAGACTGGGCCCCAGAAGACCATCGCTACATCACGGTCTC
  AGGGTGTTTGCTGGAGTACCAGTACATAGAAGTGGCTCATAGTTCCCTCCAGATTGTCCTCGCACTGGCA
  GGTTTCATCTACGCCTGTTATGTTGTGAAATGTATAACTGAAGAAGAGGACAGCTTTGATTTCATAGGTG
  GCTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGACATCTCATTTACAACTACAGCCTATGTACATGTC
  AAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300738
• ORF Size: 357 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300738.1, NP_001287667.1
• RefSeq Size: 3407
• RefSeq ORF: 357
• Locus ID: 154215
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (4) has an alternate exon in its 5' end compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG to encode an isoform (4) that has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.