NKAIN2 (NM_001300738) Human Untagged Clone

CAT#: SC333653

NKAIN2 (untagged) - Human Na+/K+ transporting ATPase interacting 2 (NKAIN2), transcript variant 4


  "NM_001300738" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NKAIN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NKAIN2
Synonyms FAM77B; NKAIP2; TCBA; TCBA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300738, the custom clone sequence may differ by one or more nucleotides


ATGGAAACAGACCTTATCCTGACTTTTAATATATCAATGCACCGATCTTGGTGGATGGAGAATGGACCAG
GATGTACGGTGACGTCAGTGACACCTGCCCCAGACTGGGCCCCAGAAGACCATCGCTACATCACGGTCTC
AGGGTGTTTGCTGGAGTACCAGTACATAGAAGTGGCTCATAGTTCCCTCCAGATTGTCCTCGCACTGGCA
GGTTTCATCTACGCCTGTTATGTTGTGAAATGTATAACTGAAGAAGAGGACAGCTTTGATTTCATAGGTG
GCTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGACATCTCATTTACAACTACAGCCTATGTACATGTC
AAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001300738
ORF Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001300738.1, NP_001287667.1
RefSeq Size 3407
RefSeq ORF 357
Locus ID 154215
Protein Families Transmembrane
Gene Summary This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) has an alternate exon in its 5' end compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG to encode an isoform (4) that has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.