MTRF1L (NM_001301872) Human Untagged Clone

CAT#: SC333670

MTRF1L (untagged) - Human mitochondrial translational release factor 1-like (MTRF1L), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MTRF1L
• Synonyms: HMRF1L; MRF1L; mtRF1a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301872, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGTCCCGGGTTCTGTGGGGCGCTGCCCGGTGGCTCTGGCCCCGCCGGGCCGTTGGCCCAGCCCGCC
  GGCCCCTGAGCTCCGGTAGCCCGCCGCTGGAGGAGCTGTTCACCCGGGGCGGGCCCTTGCGGACCTTCCT
  CGAGCGCCAGGCGGGGTCTGAAGCCCATTTGAAGGTCAGGAGGCCCGAGTTGCTGGCGGTGATCAAACTG
  CTGAACGAGAAGGAGCGGGAGCTGCGGGAGACTGAGCACTTGCTGCACGATGAGAATGAAGATTTAAGGA
  AACTTGCAGAGAATGAAATCACTTTGTGTCAAAAAGAAATAACTCAGCTGAAGCATCAGGTATGGTATTT
  CTGCAAAGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301872
• ORF Size: 363 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301872.1, NP_001288801.1
• RefSeq Size: 733
• RefSeq ORF: 363
• Locus ID: 54516
• Gene Summary: The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (6) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. This variant encodes isoform 6 which is shorter and has a distinct C-terminus, compared to isoform 1.