Dermcidin (DCD) (NM_001300854) Human Untagged Clone

CAT#: SC333683

DCD (untagged) - Human dermcidin (DCD), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DCD
• Synonyms: AIDD; DCD-1; DSEP; HCAP; PIF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300854, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGTTCATGACTCTCCTCTTCCTGACAGCTCTGGCAGGAGCCCTGGTCTGTGCCTATGATCCAGAGG
  CCGCCTCTGCCCCAGGATCGGGGAACCCTTGCCATGAAGCATCAGCAGCTCAAAAGGAAAATGCAGGTGA
  AGACCCAGGGTTAGCCAGACAGGCACCAAAGCCAAGGAAGCAGAGATCCAGCCTTCTGGAAAAAGGCCTA
  GACGGAGCAAAAAAAGCTGTGGGGGGACTCGGAAAACTAGGAAAAGATGCAGTCGAAGATCTAGAAAGCG
  TGGGTAAAGGTGGGGAAGAGAGGTTGGTCTTTGGGGCTCCTGTGAATCTAACCTCCATCCCTCTGACTTC
  TGTGAGCCGTCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300854
• ORF Size: 366 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300854.1, NP_001287783.1
• RefSeq Size: 709
• RefSeq ORF: 366
• Locus ID: 117159
• Protein Families: Secreted Protein
• Gene Summary: This antimicrobial gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (2) represents the longer transcript and encodes the longer isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.