LYRM1 (NM_001302835) Human Untagged Clone

CAT#: SC333688

LYRM1 (untagged) - Human LYR motif containing 1 (LYRM1), transcript variant 4


  "NM_001302835" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "LYRM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LYRM1
Synonyms A211C6.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302835, the custom clone sequence may differ by one or more nucleotides


ATGACAACGGCAACACGACAAGAAGTCCTTGGCCTCTACCGCAGCATTTTCAGGCTTGCGAGGAAATGGC
AGGCGACATCAGGGCAGATGGAAGACACCATCAAAGAAAAACAGTACATACTAAATGAAGCCAGAACGCT
GTTCCGGAAAAACAAAAATCTCACGGACACAGACCTAATTAAACAGTGTATAGATGAATGCACAGCCAGG
ATTGAAATTGGACTGCATTACAAGATTCCTTACCCAAGGCCAATTCATCTGCCTCCAATGGGCCTTACCC
CACTCCGAGGCCGGGGACTTCGAAGCCAAGAGAAACTGAGGAAACTTTCCAAACCAGTATATCTCAGATC
TCATGATGAAGTTTCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001302835
ORF Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001302835.1, NP_001289764.1
RefSeq Size 1672
RefSeq ORF 369
Locus ID 57149
Gene Summary The protein encoded by this gene belongs to the mitochondrial leucine/tyrosine/arginine motif family of proteins. Proteins of this family are short polypeptides that contain a leucine/tyrosine/arginine motif near the N-terminus. This gene is widely expressed with high levels in omental adipose tissue of obese individuals. In adipose tissue, the protein is localized to the nucleus where it promotes preadipocyte proliferation and lowers the rate of apoptosis to regulate adipose tissue homeostasis. Overexpression of this gene in adipocytes causes abnormal mitochondrial morphology and mitochondrial dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (4) differs in its 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.