LYRM1 (NM_001302836) Human Untagged Clone
CAT#: SC333689
LYRM1 (untagged) - Human LYR motif containing 1 (LYRM1), transcript variant 5
"NM_001302836" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LYRM1 |
Synonyms | A211C6.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302836, the custom clone sequence may differ by one or more nucleotides
ATGACAACGGCAACACGACAAGAAGTCCTTGGCCTCTACCGCAGCATTTTCAGGCTTGCGAGGAAATGGC AGGCGACATCAGGGCAGATGGAAGACACCATCAAAGAAAAACAGTACATACTAAATGAAGCCAGAACGCT GTTCCGGAAAAACAAAAATCTCACGGACACAGACCTAATTAAACAGTGTATAGATGAATGCACAGCCAGG ATTGAAATTGGACTGCATTACAAGATTCCTTACCCAAGGCCAATTCATCTGCCTCCAATGGGCCTTACCC CACTCCGAGGCCGGGGACTTCGAAGCCAAGAGAAACTGAGGAAACTTTCCAAACCAGTATATCTCAGATC TCATGATGAAGTTTCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302836 |
ORF Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001302836.1, NP_001289765.1 |
RefSeq Size | 1840 |
RefSeq ORF | 369 |
Locus ID | 57149 |
Gene Summary | The protein encoded by this gene belongs to the mitochondrial leucine/tyrosine/arginine motif family of proteins. Proteins of this family are short polypeptides that contain a leucine/tyrosine/arginine motif near the N-terminus. This gene is widely expressed with high levels in omental adipose tissue of obese individuals. In adipose tissue, the protein is localized to the nucleus where it promotes preadipocyte proliferation and lowers the rate of apoptosis to regulate adipose tissue homeostasis. Overexpression of this gene in adipocytes causes abnormal mitochondrial morphology and mitochondrial dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (5) differs in its 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235795 | LYRM1 (myc-DDK-tagged) - Human LYR motif containing 1 (LYRM1), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review