Glutathione S Transferase theta 1 (GSTT1) (NM_001293810) Human Untagged Clone

CAT#: SC333692

GSTT1 (untagged) - Human glutathione S-transferase theta 1 (GSTT1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GSTT1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001293810, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCCCTGTTTTCCTGGGTGAGCCAGTATCTCCCCAGACACTGGCAGCCACCCTGGCAGAGTTGGATG
  TGACCCTGCAGTTGCTCGAGGACAAGTTCCTCCAGAACAAGGCCTTCCTTACTGGTCCTCACATCTCCTT
  AGCTGACCTCGTAGCCATCACGGAGCTGATGCATCCCGTGGGTGCTGGCTGCCAAGTCTTCGAAGGCCGA
  CCCAAGCTGGCCACATGGCGGCAGCGCGTGGAGGCAGCAGTGGGGGAGGACCTCTTCCAGGAGGCCCATG
  AGGTCATTCTGAAGGCCAAGGACTTCCCACCTGCAGACCCCACCATAAAGCAGAAGCTGATGCCCTGGGT
  GCTGGCCATGATCCGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293810
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293810.1, NP_001280739.1
• RefSeq Size: 1021 bp
• RefSeq ORF: 369 bp
• Locus ID: 2952
• Cytogenetics: 22q11.23
• Protein Pathways: Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
• Gene Summary: 'The protein encoded by this gene, glutathione S-transferase (GST) theta 1 (GSTT1), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT1 and GSTT2/GSTT2B share 55% amino acid sequence identity and may play a role in human carcinogenesis. The GSTT1 gene is haplotype-specific and is absent from 38% of the population. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2015]'
  Transcript Variant: This variant (5) lacks an alternate exon, resulting in an alternate 5' UTR and translation initiation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Variants 3, 4, 5, 6 and 7 all encode isoform c.