FGF5 (NM_001291812) Human Untagged Clone

CAT#: SC333719

FGF5 (untagged) - Human fibroblast growth factor 5 (FGF5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF5
• Synonyms: HBGF-5; Smag-82; TCMGLY
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291812, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCAAAAAAAGGAAAACTCCATGCAAGTGCCAAGTTCACAGATGACTGCAAGTTCAGGGAGCGTTTTC
  AAGAAAATAGCTATAATACCTATGCCTCAGCAATACATAGAACTGAAAAAACAGGGCGGGAGTGGTATGT
  GGCCCTGAATAAAAGAGGAAAAGCCAAACGAGGGTGCAGCCCCCGGGTTAAACCCCAGCATATCTCTACC
  CATTTTCTGCCAAGATTCAAGCAGTCGGAGCAGCCAGAACTTTCTTTCACGGTTACTGTTCCTGAAAAGA
  AAAAGCCACCTAGCCCTATCAAGCCAAAGATTCCCCTTTCTGCACCTCGGAAAAATACCAACTCAGTGAA
  ATACAGACTCAAGTTTCGCTTTGGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291812
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291812.1, NP_001278741.1
• RefSeq Size: 5118 bp
• RefSeq ORF: 378 bp
• Locus ID: 2250
• Cytogenetics: 4q21.21
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: 'The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified as an oncogene, which confers transforming potential when transfected into mammalian cells. Targeted disruption of the homolog of this gene in mouse resulted in the phenotype of abnormally long hair, which suggested a function as an inhibitor of hair elongation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) differs in the 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.