EDF1 (NM_001281298) Human Untagged Clone

CAT#: SC333741

EDF1 (untagged) - Human endothelial differentiation-related factor 1 (EDF1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EDF1
• Synonyms: CFAP280; EDF-1; MBF1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281298, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGAGAGCGACTGGGACACGGTGACGGTGCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAAT
  CCAAGCAGGCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAATGGGCTGCTGG
  CCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGGAGACAGAGGAGCTGCACCAT
  GACAGGGTGACCCTGGAGAAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCA
  TACCCAATAACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGGCCTCAAGCTCCGGGGAAAGGACATTGG
  AAAGCCCATCGAGAAGGGGCCTAGGGCGAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281298
• ORF Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001281298.1, NP_001268227.1
• RefSeq Size: 638
• RefSeq ORF: 384
• Locus ID: 8721
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (4) uses an alternate in-frame splice site in the central coding region, compared to variant alpha. The encoded isoform (4) is shorter, compared to isoform alpha.