PHPT1 (NM_001287342) Human Untagged Clone

CAT#: SC333744

PHPT1 (untagged) - Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 4


  "NM_001287342" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHPT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHPT1
Synonyms CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287342, the custom clone sequence may differ by one or more nucleotides


ATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGACATCGACTCCGACGGCGTCTTCAAGTATGTGC
TGATCCGAGTCCACTCGGCTCCCCGCTCCGGGGCTCCGGCTGCAGAGAGCAAGGAGATCGTGCGCGGCTA
CAAGTGGGCTGAGTACCATGGTGAGGCGGACATCTACGACAAAGTGTCGGGCGACATGCAGAAGCAAGGC
TGCGACTGTGAGTGTCTGGGCGGCGGGCGCATCTCCCACCAGAGTCAGGACAAGAAGATTCACGTGTACG
GCTATTCCATGGCCTATGGTCCTGCCCAGCACGCCATTTCAACTGAGAAAATCAAAGCCAAGTACCCCGA
CTACGAGGTCACCTGGGCTAACGACGGCTACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287342
ORF Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001287342.1, NP_001274271.1
RefSeq Size 1205
RefSeq ORF 384
Locus ID 29085
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
Gene Summary This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (4) encodes the longest isoform (4).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.