PHPT1 (NM_001287342) Human Untagged Clone

CAT#: SC333744

PHPT1 (untagged) - Human phosphohistidine phosphatase 1 (PHPT1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PHPT1
• Synonyms: CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001287342, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGTGGCGGACCTCGCTCTCATTCCTGATGTGGACATCGACTCCGACGGCGTCTTCAAGTATGTGC
  TGATCCGAGTCCACTCGGCTCCCCGCTCCGGGGCTCCGGCTGCAGAGAGCAAGGAGATCGTGCGCGGCTA
  CAAGTGGGCTGAGTACCATGGTGAGGCGGACATCTACGACAAAGTGTCGGGCGACATGCAGAAGCAAGGC
  TGCGACTGTGAGTGTCTGGGCGGCGGGCGCATCTCCCACCAGAGTCAGGACAAGAAGATTCACGTGTACG
  GCTATTCCATGGCCTATGGTCCTGCCCAGCACGCCATTTCAACTGAGAAAATCAAAGCCAAGTACCCCGA
  CTACGAGGTCACCTGGGCTAACGACGGCTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001287342
• ORF Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001287342.1, NP_001274271.1
• RefSeq Size: 1205
• RefSeq ORF: 384
• Locus ID: 29085
• Protein Families: Druggable Genome
• Protein Pathways: Fructose and mannose metabolism, Metabolic pathways, Riboflavin metabolism, Thiamine metabolism
• Gene Summary: This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (4) encodes the longest isoform (4).