SPINLW1 (EPPIN) (NM_001302861) Human Untagged Clone

CAT#: SC333745

EPPIN (untagged) - Human epididymal peptidase inhibitor (EPPIN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EPPIN
• Synonyms: CT71; CT72; dJ461P17.2; SPINLW1; WAP7; WFDC7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302861, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGATCTTCTGGACTTTTGAGCCTCCTGGTGCTATTCGTCCTCTTAGCGAATGTCCAGGGACCTGGTC
  TGACTGATTGGTTATTTCCCAGGAGATGTCCCAAAATCAGAGAAGAATGTGAATTCCAAGAAAGGGATGT
  GTGTACAAAGGACAGACAATGCCAGGACAACAAGAAGTGTTGTGTCTTCAGCTGCGGAAAAAAATGTTTA
  GATCTCAAACAAGTCTCTCTGCAGATGTATGCGAAATGCCAAAAGAAACTGGCCCCTGCCTGGCTTATTT
  TCTTCATTGGTGGTATGACAAGAAAGATAATACTTGCTCCATGTTTGTCTATGGTGGCTGCCAGGGAAAC
  AATAACAACTTCCAATCCAAAGCCAACTGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302861
• ORF Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001302861.1, NP_001289790.1
• RefSeq Size: 800
• RefSeq ORF: 384
• Locus ID: 57119
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes an epididymal protease inhibitor, which contains both kunitz-type and WAP-type four-disulfide core (WFDC) protease inhibitor consensus sequences. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene is a member of the WFDC gene family and belongs to the telomeric cluster. The protein can inhibit human sperm motility and exhibits antimicrobial activity against E. coli, and polymorphisms in this gene are associated with male infertility. Read-through transcription also exists between this gene and the downstream WFDC6 (WAP four-disulfide core domain 6) gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) uses an alternate splice junction in a 3' coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.