Prol1 (OPRPN) (NM_001302807) Human Untagged Clone

CAT#: SC333750

PROL1 (untagged) - Human proline rich, lacrimal 1 (PROL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OPRPN
• Synonyms: BPLP; opiorphin; PRL1; PROL1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302807, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAATTAACTTTCTTCTTGGGCCTGTTGGCTCTTATTTCATGTTTCACATCAGCGGTTGCTAAGCATG
  AAGGGACAGTGGACTGCAGGAAGAGGACACAGGGCAGCCCAGTGAGAGTCAAAGATTCTCCAGAAGACCA
  TATCTACCTGGCCAGCTGCCACCACCTCCACTCTACAGGCCAAGATGGGTTCCACCAAGTCCCCCACCTC
  CCTATGACTCAAGACTTAATTCACCACTTTCTCTTCCCTTTGTCCCAGGGCGAGTTCCACCATCTTCTTT
  CTCTCGATTTAGCCAAGCAGTCATTCTATCTCAACTCTTTCCATTGGAATCTATTAGACAACCTCGACTC
  TTTCCGGGTTATCCAAACCTACATTTCCCACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302807
• ORF Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001302807.1, NP_001289736.1
• RefSeq Size: 1116
• RefSeq ORF: 384
• Locus ID: 58503
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the proline-rich protein family. The encoded protein has multiple proposed functions, including roles in pain suppression, penile erection, and protection of the eye surface. The QRFSR pentapeptide, known as opiorphin, is derived from the N-terminal of this protein. Opiorphin inhibits the enkephalin-inactivating peptidases neprilysin and aminopeptidase N, and this activity is thought to reduce sensitivity to painful stimuli by effecting enkephalin-related activation of opioid-dependent pathways. Opiorphin may also act as an anti-depressant. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (2) contains an alternate exon in the 5' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. This isoform (2) lacks the functional QRFSR pentapeptide, known as opiorphin, located in the N-terminal of isoform 1.