NUDT4 (NM_001301023) Human Untagged Clone

CAT#: SC333758

NUDT4 (untagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4), transcript variant 4


  "NM_001301023" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NUDT4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NUDT4
Synonyms DIPP-2B; DIPP2; DIPP2alpha; DIPP2beta; HDCMB47P; NUDT4B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301023, the custom clone sequence may differ by one or more nucleotides


ATGGAACCCGAGGAGGAACCTGGCGGTGCTGCCGTGAGGGAAGTTTATGAGGAGGCTGGAGTCAAAGGAA
AACTAGGCAGACTTCTGGGCATATTTGAGAACCAAGACCGAAAGCACAGAACATATGTTTATGTTCTAAC
AGTCACTGAAATATTAGAAGATTGGGAAGATTCTGTTAATATTGGAAGGAAGAGAGAGTGGTTCAAAGTA
GAAGATGCTATCAAAGTTCTCCAGTGTCATAAACCTGTACATGCAGAGTATCTGGAAAAGCTAAAGCTGG
GTTGTTCCCCAGCCAATGGAAATTCTACAGTCCCTTCCCTTCCGGATAATAATGCCTTGTTTGTAACCGC
TGCACAGACCTCTGGGTTGCCATCTAGTGTAAGATAG


Restriction Sites SgfI-MluI     
ACCN NM_001301023
ORF Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001301023.1, NP_001287952.1
RefSeq Size 4554
RefSeq ORF 387
Locus ID 11163
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene regulates the turnover of diphosphoinositol polyphosphates. The turnover of these high-energy diphosphoinositol polyphosphates represents a molecular switching activity with important regulatory consequences. Molecular switching by diphosphoinositol polyphosphates may contribute to regulating intracellular trafficking. Several alternatively spliced transcript variants have been described, but the full-length nature of some variants has not been determined. Isoforms DIPP2alpha and DIPP2beta are distinguishable from each other solely by DIPP2beta possessing one additional amino acid due to intron boundary skidding in alternate splicing. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) contains an alternate 5' terminal exon, and uses an alternate splice site in the 5' coding region, resulting in the use of a downstream start codon compared to variant 2. The encoded isoform (4) has a shorter N-terminus compared to isoform beta. Variants 4 and 5 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.