SURF4 (NM_001280792) Human Untagged Clone

CAT#: SC333760

SURF4 (untagged) - Human surfeit 4 (SURF4), transcript variant 6


  "NM_001280792" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SURF4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SURF4
Synonyms ERV29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001280792, the custom clone sequence may differ by one or more nucleotides


ATGGGCCAGAACGACCTGATGGGCACGGCCGAGGACTTCGCCGACCAGTTCCTCCGTGTCACAAAGCAGT
ACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTGGAGGACGGCATCCGTATGTGGTTCCA
GTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCCTCGTCCTTCGTC
TTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTCGTGCAGTACGCCT
GCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGGGACTTGAAGTTTTT
GATGAGATTGTCCAGAACATCGTGGGCACAGCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001280792
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001280792.1, NP_001267721.1
RefSeq Size 2881 bp
RefSeq ORF 387 bp
Locus ID 6836
Cytogenetics 9q34.2
Protein Families Transmembrane
Gene Summary 'This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (6) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (5) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.