KCNMA1 (NM_001271521) Human Untagged Clone

CAT#: SC333761

KCNMA1 (untagged) - Human potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNMA1
• Synonyms: bA205K10.1; BKTM; CADEDS; hSlo; KCa1.1; MaxiK; mSLO1; PNKD3; SAKCA; SLO; SLO-ALPHA; SLO1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271521, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTTA
  GAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCTTC
  CTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTCATC
  ATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCCTCCT
  CCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGGACCGT
  GTGCTGCCACTGCGGGGGCAAGACGAAGGTGCTCTAG
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001271521
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271521.1, NP_001258450.1
• RefSeq Size: 948 bp
• RefSeq ORF: 387 bp
• Locus ID: 3778
• Cytogenetics: 10q22.3
• Protein Families: Druggable Genome, Ion Channels: Potassium, Transmembrane
• Protein Pathways: Vascular smooth muscle contraction
• Gene Summary: 'MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (8) is a two-exon transcript with a distinct 3'UTR compared to variant 1. The predicted protein (short2) has a distinct C-terminus and is significantly shorter than isoform a. It is unknown if this protein is stable or has any function.