NUDT4 (NM_001301022) Human Untagged Clone

CAT#: SC333771

NUDT4 (untagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 4 (NUDT4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NUDT4
• Synonyms: DIPP-2B; DIPP2; DIPP2alpha; DIPP2beta; HDCMB47P; NUDT4B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301022, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACCCGAGGAGGAACCTGGCGGTGCTGCCGTGAGGGAAGTTTATGAGGAGGCTGGAGTCAAAGGAA
  AACTAGGCAGACTTCTGGGCATATTTGAGCAGAACCAAGACCGAAAGCACAGAACATATGTTTATGTTCT
  AACAGTCACTGAAATATTAGAAGATTGGGAAGATTCTGTTAATATTGGAAGGAAGAGAGAGTGGTTCAAA
  GTAGAAGATGCTATCAAAGTTCTCCAGTGTCATAAACCTGTACATGCAGAGTATCTGGAAAAGCTAAAGC
  TGGGTTGTTCCCCAGCCAATGGAAATTCTACAGTCCCTTCCCTTCCGGATAATAATGCCTTGTTTGTAAC
  CGCTGCACAGACCTCTGGGTTGCCATCTAGTGTAAGATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301022
• ORF Size: 390 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001301022.1, NP_001287951.1
• RefSeq Size: 4557
• RefSeq ORF: 390
• Locus ID: 11163
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene regulates the turnover of diphosphoinositol polyphosphates. The turnover of these high-energy diphosphoinositol polyphosphates represents a molecular switching activity with important regulatory consequences. Molecular switching by diphosphoinositol polyphosphates may contribute to regulating intracellular trafficking. Several alternatively spliced transcript variants have been described, but the full-length nature of some variants has not been determined. Isoforms DIPP2alpha and DIPP2beta are distinguishable from each other solely by DIPP2beta possessing one additional amino acid due to intron boundary skidding in alternate splicing. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) contains an alternate 5' terminal exon, resulting in the use of a downstream start codon compared to variant 2. The encoded isoform (3) has a shorter N-terminus compared to isoform beta. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.