EDF1 (NM_001281299) Human Untagged Clone

CAT#: SC333779

EDF1 (untagged) - Human endothelial differentiation-related factor 1 (EDF1), transcript variant 5


  "NM_001281299" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "EDF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EDF1
Synonyms CFAP280; EDF-1; MBF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281299, the custom clone sequence may differ by one or more nucleotides


ATGGCCGAGAGCGACTGGGACACGGTGACGGTGCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAAT
CCAAGCAGGCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAATGGGCTGCTGG
CCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGGAGACAGAGGAGCTGCACCAT
GACAGGGTGACCCTGGAGGTGGGCAAGAAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCG
GACGGGCCATACCCAATAACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGGCCTCAAGCTCCGGGGAAA
GGACATTGGAAAGCCCATCGAGAAGGGGCCTAGGGCGAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001281299
ORF Size 393 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001281299.1, NP_001268228.1
RefSeq Size 647
RefSeq ORF 393
Locus ID 8721
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (5) uses an alternate in-frame splice site in the central coding region, compared to variant alpha. The encoded isoform (5) is shorter, compared to isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.