ZNF302 (NM_018675) Human Untagged Clone

CAT#: SC333796

ZNF302 (untagged) - Human zinc finger protein 302 (ZNF302), transcript variant 15

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF302
• Synonyms: HSD16; MST154; MSTP154; ZNF135L; ZNF140L; ZNF327
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_018675, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTCAGGTGACATTTAGTGATGTGGCTATAGACTTCTCTCATGAAGAGTGGGCATGCCTAGATTCTG
  CTCAGAGGGACTTATACAAGGATGTGATGGTCCAGAATTATGAGAACCTGGTCTCTGTAGGTCTTTCCGT
  AACTAAGCCATATGTGATCATGTTATTGGAGGATGGAAAAGAGCCCTGGATGATGGAGAAAAAACTGTCA
  AAAGCTTACCCATTTCCTTTATCACACTCTGTTCCTGCTTCTGTGAACTTTGGATTCTCTGCTCTATTTG
  AGCATTGTTCAGAAGTCACTGAAATATTTGAGTTGTCAGAACTATGTGTTTTCTGGGTGCTTCATTTCTT
  ATCCAATTCTCCTAATTCCACTGTAGAAGCTTTTTTCAAGAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_018675
• ORF Size: 396 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_018675.2, NP_061145.2
• RefSeq Size: 3195
• RefSeq ORF: 396
• Locus ID: 55900
• Domains: KRAB, zf-C2H2
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the zinc-finger protein family. The encoded protein contains seven C2H2-type zinc fingers and a KRAB domain, but its function has yet to be determined. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2014]
  Transcript Variant: This variant (15) differs in the 5' UTR, lacks an alternate in-frame exon, and uses an alternate splice junction compared to variant 1. The resulting isoform (e) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a. Variants 12, 13, 14, and 15 all encode the same isoform (e).