SCLT1 (NM_001300898) Human Untagged Clone

CAT#: SC333808

SCLT1 (untagged) - Human sodium channel and clathrin linker 1 (SCLT1), transcript variant 3


  "NM_001300898" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SCLT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SCLT1
Synonyms CAP-1A; CAP1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300898, the custom clone sequence may differ by one or more nucleotides


ATGGCTGCAGAAATCGACTTTCTGAGAGAGCAAAATCGAAGACTAAATGAAGATTTTAGGCGGTATCAAA
TGGAAAGTTTTTCCAAATATTCATCTGTACAGAAAGCTGTCTGCCAAGGAGAAGGAGACGACACATTTGA
AAACCTAGTATTTGACCAAAGCTTTTTAGCTCCTCTTGTTACTGAGTATGATAAACACCTAGGAGAACTA
AATGGGCAGCTGAAATATTACCAGAAACAGGTGGGTGAGATGAAATTACAACTTGAAAATGTCATCAAGG
AAAATGAAAGAGTCTTGCTCTGTCTCCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACTGCAAGCTC
CGCCTCCCGGATTCGTGCCATTCTCCTGCCTCAGCCTCCCCAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001300898
ORF Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001300898.1, NP_001287827.1
RefSeq Size 2373
RefSeq ORF 396
Locus ID 132320
Gene Summary This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (3) lacks several exons and uses an alternate 3'-terminal exon, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.